|
Resolution: standard / high Figure 4.
A) RT-PCR demonstrating deletion of exons 4 and 5 from the CSMD1 transcripts of cell lines PCI-13 and UPCI:SCC066. RT-PCR with a forward primer in exon 3 (prm2080, gggatttcagctgccctcctctat) and a reverse primer in exon 6 (prm1405, cttggaactgagcgttaaatcctttg) yields a 623 bp product from upper aerodigestive tract (UPPP), human fetal brain (HFB) and UPCI:SCC066 RNA. Exclusion of exons 4 and 5 from the transcripts of PCI-13 and UPCI:SCC066 reduces the size of the PCR product to 220 bp. The sizes of the DNA standards (STD) are indicated on the left side of the figure. The blank reaction contained water instead of cDNA. "UPPP" = normal oropharyngeal epithelium isolated from uvulopalatopharyngoplasty surgical discards. B) Idiogram showing the organization of exons 3 through 6 in the human genome. The sizes of the introns were obtained from the UCSC genome browser. The sequences of the splice junctions are provided above the idiogram with intronic bases in lowercase and exonic bases in uppercase. The structure of the UPCI:SCC066 and PCI-13 CSMD1 transcripts are shown below the idiogram.
Richter et al. Cancer Cell International 2005 5:29 doi:10.1186/1475-2867-5-29 |