|
Resolution: standard / high Figure 6.
5aza-dC induced activation of CSMD1 from the same cryptic promoter active in cell line SCC9. Cultures of cell line 094 were treated with the indicated micromolar concentrations of 5aza-dC, and used for RNA extraction. Cell line SCC9 was grown in the absence of the drug and used as a control. RT-PCR was performed with primers prm1904 (cgtttagttcgacacacttcatgt) and prm1880 (cactggaaggagagcacgtcgttcac). prm1904 is specific for the cryptic first exon first used in SCC9, prm1880 is homologous to CSMD1 exon 38. The presence or absence of reverse transcriptase in the RT reaction is indicated by a + or -, respectively. The blank reaction contained water instead of input cDNA. The sizes of the markers are indicated on the left side of the figure.
Richter et al. Cancer Cell International 2005 5:29 doi:10.1186/1475-2867-5-29 |